Peptide mapping is one of those subjects where the details matter more than the headlines. This page pulls together the background, the mechanisms, and the practical points readers ask about most.
Updated 2026-03-19. Numbers and descriptions here follow the published literature rather than marketing material.
Naming conventions place Selank in the same research family as Semax, another Russian-developed peptide investigated for cognitive effects. The two compounds share a lineage but differ in sequence and in the biological systems proposed as their targets. Semax descends from ACTH fragments, whereas Selank descends from tuftsin. Publications sometimes identify Selank by its full peptide sequence or by laboratory codes rather than one uniform trade name. Because replication outside Russia is limited, reports on its properties are best read alongside the study design and the purity of the material tested.
Selank is a synthetic heptapeptide developed in Russia during the 1990s. Researchers at the Institute of Molecular Genetics of the Russian Academy of Sciences designed it as a stabilized analog of tuftsin, a naturally occurring immunomodulatory tetrapeptide. The compound has been studied primarily for its reported anxiolytic and nootropic effects. It remains largely unknown in Western pharmacology and is not approved as a medicine by major regulators such as the FDA or the EMA.
Dry powder is normally held at -20 degrees Celsius or lower, in a sealed container with desiccant and protection from light. Reconstituted solutions are usually kept at 2 to 8 degrees Celsius for short periods and frozen for longer ones. Proline residues at several positions are generally associated with some resistance to peptidase attack, but chemical stability still declines at neutral to alkaline pH and at elevated temperature. Exact shelf-life figures are product-specific and are not standardised across suppliers.
Identity and purity are usually assessed by reversed-phase high-performance liquid chromatography, with mass spectrometry used to confirm molecular mass and sequence information. Amino acid analysis and peptide mapping may supplement these methods. Certified reference standards are scarce, and many commercial lots are sold as research chemicals without a pharmacopoeial monograph. Regulatory treatment differs by country: Selank is a registered prescription medicine in Russia, while in the European Union and the United States it is not an approved drug and may fall under research-chemical or unapproved-product frameworks.
| Property | Value | Notes |
|---|---|---|
| Molecular class | Synthetic heptapeptide | Stabilized analog of tuftsin |
| Sequence | Thr-Lys-Pro-Arg-Pro-Gly-Pro | Single-letter form: TKPRPGP |
| Molecular formula | C33H57N11O9 | Monoisotopic mass about 751.9 Da |
| Appearance | White to off-white powder | Typically supplied as lyophilized solid |
| Solubility | Freely soluble in water | Also soluble in common polar solvents |
Outside its country of origin the compound is generally handled as a research chemical rather than an approved medicine. No regulatory approval from the United States Food and Drug Administration or the European Medicines Agency has been granted for human use. Identity and purity are normally checked by reverse-phase high-performance liquid chromatography, with mass spectrometry used to confirm the molecular mass. Lyophilised material is stored cold and desiccated, and repeated freeze-thaw cycles are avoided.
Published work on this peptide almost always uses intranasal delivery, with drops or a spray applied to the nasal mucosa. Some animal experiments have used subcutaneous or intraperitoneal injection, and a smaller number have compared routes directly. Oral administration is not a focus of the literature, because short peptides of this size are broken down by digestive enzymes and cross intestinal barriers poorly. How much of an intranasal dose reaches the bloodstream intact in humans remains an open question.
Lyophilized material is generally stable for extended periods when kept dry at or below minus twenty degrees Celsius. Working solutions are less stable, and common practice is to aliquot and freeze them so that repeated freeze-thaw cycles are avoided. Aqueous solutions are sensitive to pH extremes and to microbial growth, so short-term storage at refrigerator temperature is typical. Oxidation and hydrolysis are the principal degradation routes. Reconstitution with sterile water or a mild buffer is standard, and solutions should be protected from light.
Regulatory treatment varies by jurisdiction. In Russia the compound is a registered prescription product, while in the European Union and the United States it is generally handled as a research chemical without a marketing authorization. Suppliers therefore operate outside pharmaceutical oversight, and buyers rely on supplier documentation for purity and identity claims. Chain of custody and third-party testing are the main verification tools. Analysts note that the absence of a pharmacopoeial monograph for research-grade material limits standardization across vendors.
Lyophilized selank is normally supplied as a dry powder and is considered stable for extended periods when kept cold and dry. Moisture uptake is the main practical threat, because absorbed water promotes both hydrolysis and aggregation in the solid state. Vials are usually warmed to room temperature before opening so that condensation does not form on the powder. Supplier documentation commonly specifies -20 °C for routine storage, with -80 °C used for material intended to be archived for years.
Once dissolved, the peptide is markedly less stable than the dry powder. Aqueous solutions are subject to backbone hydrolysis and to microbial growth when they are handled without sterile technique. Buffered solutions near neutral pH are common for short-term laboratory work, while acidic conditions are sometimes used to improve solubility. Analytical laboratories generally prepare working solutions fresh rather than storing them, and a residual water film left in a reopened vial can seed degradation even when the container appears dry.
Proposed mechanisms centre on modulation of the GABAergic system, with reports of altered expression of genes related to GABA-A receptor subunits and changed monoamine turnover. Some studies describe inhibition of enkephalinase, the enzyme that degrades endogenous enkephalins, which may prolong opioid peptide signalling. Effects on brain-derived neurotrophic factor and on cytokine expression have also been reported. These findings come largely from animal models and small human studies, and the precise primary target remains unresolved.
Published clinical evidence is limited. Most controlled trials were conducted in Russia, enrolled modest numbers of participants, and appeared in Russian-language journals, which restricts independent verification. Reported outcomes include lower anxiety scores, improved attention and memory measures, and changes in fatigue ratings. Reviews written in English note methodological limitations such as small samples and inconsistent endpoints. Whether the compound produces clinically meaningful benefit relative to established anxiolytics is therefore an open question rather than an established finding.
Selank is a synthetic heptapeptide with the sequence Thr-Lys-Pro-Arg-Pro-Gly-Pro. It was designed at the Institute of Molecular Genetics of the Russian Academy of Sciences as a structural analogue of tuftsin, a naturally occurring tetrapeptide fragment of the immunoglobulin heavy chain. The added Pro-Gly-Pro tail was intended to slow enzymatic degradation and extend biological activity. In Russia it is registered as an anxiolytic nasal preparation, while regulators elsewhere have not approved it for clinical use.
As such, feeling is only one of the conditions for craving (another one is ignorance). Therefore, in this Buddhist view of causality, nothing has a single cause. Bodhi agrees with this, stating that not all conditional relations in dependent arising are based on direct causal necessitation. While in some cases there is a direct necessary relationship between the phenomena outlined in the lists (birth will always lead to death), in other cases there is not. This is an important point because as Bodhi notes, "if dependent arising described a series in which each factor necessitated the next, the series could never be broken," and liberation would be impossible.
Hsp20 also serves a significant role in preventing platelet aggregation, cardiac myocyte function and prevention of apoptosis after ischemic injury, and skeletal muscle function and muscle insulin response. Hsp27 is a major phosphoprotein during women's contractions. Hsp27 functions in small muscle migrations and appears to serve an integral role.
=== Bacterial or viral === As bacterial and viral infections can both cause the same kinds of symptoms, it can be difficult to distinguish which is the cause of a specific infection. Distinguishing the two is important, since viral infections cannot be cured by antibiotics whereas bacterial infections can.
In 1959 Ernst Freese coined the terms "transitions" or "transversions" to categorize different types of point mutations. Transitions are replacement of a purine base with another purine or replacement of a pyrimidine with another pyrimidine. Transversions are replacement of a purine with a pyrimidine or vice versa. There is a systematic difference in mutation rates for transitions (Alpha) and transversions (Beta). Transition mutations are about ten times more common than transversions.
Sources: en.wikipedia.org
The layers of the body can be approximated as a thin layer of epidermis, dermis, adipose tissue (subcutaneous fat), and muscle tissue. At dozens of gigahertz, the radiation is absorbed in the top fraction to top few millimeters of skin. Muscle tissue is a much more efficient absorber than fat, so at lower frequencies that can penetrate sufficiently deep, most energy gets deposited there. In a homogeneous medium, the energy-depth dependence is an exponential curve with the exponent depending on the frequency and tissue. For 2.5 GHz, the first millimeter of muscle tissue absorbs 11% of the heat energy, the first two millimeters together absorb 20%. For lower frequencies, the attenuation factors are much lower, the achievable heating depths are higher, and the temperature gradient within the tissue is lower.
where N is 100, nx is the percentage of sequences with residue x (e.g. methionine) at position i, and px corresponds to the approximate distribution of amino acid x in all positions among all sequenced proteins. The summation runs over all 20 amino acids. After ΔGistat is computed, the conservation for position i in a subalignment produced after a perturbation of amino acid distribution at j (ΔGi | δjstat) is taken. Statistical coupling energy, denoted ΔΔGi, jstat, is simply the difference between these two values. That is:
Here, the phosphorylated 5′ end of the RNA strand enters a conserved basic surface pocket and makes contacts through a divalent cation (an atom with two positive charges) such as magnesium and by aromatic stacking (a process that allows more than one atom to share an electron by passing it back and forth) between the 5′ nucleotide in the siRNA and a conserved tyrosine residue. This site is thought to form a nucleation site for the binding of the siRNA to its mRNA target. Analysis of the inhibitory effect of mismatches in either the 5' or 3' end of the guide strand has demonstrated that the 5' end of the guide strand is likely responsible for matching and binding the target mRNA, while the 3' end is responsible for physically arranging target mRNA into a cleavage-favorable RISC region. It is not understood how the activated RISC complex locates complementary mRNAs within the cell. Although the cleavage process has been proposed to be linked to translation, translation of the mRNA target is not essential for RNAi-mediated degradation. Indeed, RNAi may be more effective against mRNA targets that are not translated. Argonaute proteins are localized to specific regions in the cytoplasm called P-bodies (also cytoplasmic bodies or GW bodies), which are regions with high rates of mRNA decay; miRNA activity is also clustered in P-bodies. Disruption of P-bodies decreases the efficiency of RNAi, suggesting that they are a critical site in the RNAi process.
Claims that growth hormone enhances physical performance are not supported by the scientific literature. Although the limited available evidence suggests that growth hormone increases lean body mass, it may not improve strength; in addition, it may worsen exercise capacity and increase adverse events. More research is needed to conclusively determine the effects of growth hormone on athletic performance.
=== Elimination === The average elimination half-life in healthy adults is 5.8–8.7 (mean 6.5) hours, with some reviews estimated half-life is up to 10 hours. In people with renal impairment, the average elimination half-life increases to 11.4–15.7 hours.
Sources: en.wikipedia.org
=== Analytical reagent === Several chemical tests utilize copper sulfate. It is used in Fehling's solution and Benedict's solution to test for reducing sugars, which reduce the soluble blue copper(II) sulfate to insoluble red copper(I) oxide. Copper(II) sulfate is also used in the Biuret reagent to test for proteins. Copper sulfate is used to test blood for anemia. The blood is dropped into a solution of copper sulfate of known specific gravity—blood with sufficient hemoglobin sinks rapidly due to its density, whereas blood which sinks slowly or not at all has an insufficient amount of hemoglobin. Clinically relevant, however, modern laboratories utilize automated blood analyzers for accurate quantitative hemoglobin determinations, as opposed to older qualitative means. In a flame test, the copper ions of copper sulfate emit a deep green light, a much deeper green than the flame test for barium.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
The North American Bear Center, located in Ely, Minnesota, is home to the world's largest captive male and female American black bears. Ted, the male, weighed 431–453.5 kg (950–1,000 lb) in the fall of 2006. Honey, the female, weighed 219.6 kg (484 lb) in the fall of 2007.
== Inhibitors == There are two types of inhibitor of PPO, those competitive to oxygen in the copper site of the enzyme and those competitive to phenolics. Tentoxin has also been used in recent research to eliminate the PPO activity from seedlings of higher plants. Tropolone is a grape polyphenol oxidase inhibitor. Another inhibitor of this enzyme is potassium metabisulfite. Banana root PPO activity is strongly inhibited by dithiothreitol and sodium metabisulfite, as is banana fruit PPO by similar sulfur-containing compounds including sodium dithionite and cysteine, in addition to ascorbic acid (vitamin C).
Sources: en.wikipedia.org
Selank is a synthetic heptapeptide designed as a stabilized analog of the natural tetrapeptide tuftsin. It has been investigated mainly for anxiolytic and cognitive effects. It is not an approved pharmaceutical in most countries.
It was developed in Russia, at the Institute of Molecular Genetics of the Russian Academy of Sciences, during the 1990s. Most published research originates from Russian institutions. Independent international replication remains limited.
Tuftsin is a natural tetrapeptide with the sequence Thr-Lys-Pro-Arg that participates in immune signaling. Selank extends that sequence with Pro-Gly-Pro at the C-terminus. The added residues are linked to greater resistance to enzymatic breakdown.
Dry powder is normally held at -20 degrees Celsius or below in a sealed, light-protected container with desiccant. Brief room-temperature handling during weighing is generally tolerated. Storage instructions vary between suppliers, so the accompanying certificate of analysis should be followed.